Level- Data

RT-qPCR assay

Last updated:

Total hit(s): 26

Select item(s)	Key Findings	Comments (You can add your comments too!)	Original Article (hover to see details)

Reporting a novel nsp1 real-time RT-PCR assay for the detection of SARS-CoV-2, based on nanopore sequencing.

nsp1 gene was identified as a highlyexpressed gene in all samples via Nanopore wholegenome sequencing. This assay is unique because it target the nsp1 gene which is located at the 5' end of the genome, while the other assays targets the middle or the end of the SARS-CoV-2 genome. ✍

32501535
(J Med Virol)

PMID	32501535 Date of Publishing: 2020 Nov
Title	Identification of nsp1 gene as the target of SARS-CoV-2 real time RT-PCR using nanopore whole genome sequencing
Author(s) name	Chan WM, Ip JD et al.
Journal	J Med Virol
Impact factor	2.07 Citation count: 20

NLM format
Chan WM, Ip JD, Chu AW, Yip CC, Lo LS, Chan KH, Ng AC, Poon RW, To WK, Tsang OT, Leung WS, Kwan MY, Chua GT, Chung TW, Hung IF, Kok KH, Cheng VC, Chan JF, Yuen KY, To KK. Identification of nsp1 gene as the target of SARS-CoV-2 real time RT-PCR using nanopore whole genome sequencing. J Med Virol. 2020 Nov;92(11):2725-2734. PMID:32501535

In this study, the RT-PCR assays were conducted using three protocols, CDC, NIID, and YCH assay for the diagnosis of SARS-CoV-2. The YCH assay targets 2 sites of the N gene (YCH-N1, and YCH-N2) and utilizes double-quencher probes. The double quencher probe reduced the background signal and detected SARS-CoV-2 in the low viral load clinical specimens.

The expected amplicon sizes for the YCH assays are 158 bp for the N2 genes ✍

32650037
(J Virol Methods)

PMID	32650037 Date of Publishing: 2020 Oct
Title	Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay
Author(s) name	Hirotsu Y, Mochizuki H, Omata M.
Journal	J Virol Methods
Impact factor	1.76 Citation count: 29

NLM format
Hirotsu Y, Mochizuki H, Omata M. Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay. J Virol Methods. 2020 Oct;284:113926. PMID:32650037

In this study, the RT-PCR assays were conducted using three protocols, CDC, NIID, and YCH assay for the diagnosis of SARS-CoV-2. The NIID assay (Japan) targets 2 sites of the N gene (NIID-N1, NIID-N2) and utilizes single-quencher probes. The positive detection rate of N2 was higher than that of the N1 site.

The expected amplicon sizes for the NIID are 128 bp for the N1 genes ✍

32650037
(J Virol Methods)

PMID	32650037 Date of Publishing: 2020 Oct
Title	Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay
Author(s) name	Hirotsu Y, Mochizuki H, Omata M.
Journal	J Virol Methods
Impact factor	1.76 Citation count: 29

NLM format
Hirotsu Y, Mochizuki H, Omata M. Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay. J Virol Methods. 2020 Oct;284:113926. PMID:32650037

In this study, the RT-PCR assays were conducted using three protocols, CDC, NIID, and YCH assay for the diagnosis of SARS-CoV-2. The CDC (USA) protocol targets 3 sites of the N gene (CDC-N1, CDC-N2, CDC-N3) and utilizes single-quencher probes. The CDC-N2 assay had a limit of detection of 10 copies of the DNA positive control.

The expected amplicon sizes for the CDC assay are 72, 67, and 72 bp for the N1, N2, and N3 genes, respectively ✍

32650037
(J Virol Methods)

PMID	32650037 Date of Publishing: 2020 Oct
Title	Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay
Author(s) name	Hirotsu Y, Mochizuki H, Omata M.
Journal	J Virol Methods
Impact factor	1.76 Citation count: 29

NLM format
Hirotsu Y, Mochizuki H, Omata M. Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay. J Virol Methods. 2020 Oct;284:113926. PMID:32650037

In this study, a real-time RT-PCR assay was assessed by a sample pooling strategy. The study revealed that pooling of up to 10 samples per pool increased test capacity, with 60% of resource-saving, and detected positive samples with sufficient diagnostic accuracy. Ct values were lower in retested positive individual samples compared with pools.

This approach can facilitate mass screening in the early coming stages of COVID-19 outbreaks.
One limitation of poolong is that the detection time is stretched. ✍

32869865
(J Med Virol)

PMID	32869865 Date of Publishing: 2020 Sep 1
Title	Evaluation of sample pooling for diagnosis of COVID- 19 by real-time PCR : A resource-saving combat stratergy
Author(s) name	Garg J, Singh V et al.
Journal	J Med Virol
Impact factor	2.07 Citation count: 21

NLM format
Garg J, Singh V, Pandey P, Verma A, Sen M, Das A, Agarwal J. Evaluation of sample pooling for diagnosis of COVID- 19 by real-time PCR : A resource-saving combat stratergy. J Med Virol. 2021 Mar;93(3):1526-1531. PMID:32869865

Reporting a one-step SYBR Green-based RT-qPCR assay specific for the E gene of SARS-CoV-2, which can be used as a lower-cost alternative to TaqMan RT-qPCR assay.

The SYBR Green-based assay was able to detect all 8 dilutions of the isolate. The average Ct variation between SYBR Green and TaqMan was 1.92 ✍

32767275
(Braz J Microbiol)

PMID	32767275 Date of Publishing: 2020 Sep
Title	Lower cost alternatives for molecular diagnosis of COVID-19: conventional RT-PCR and SYBR Green-based RT-qPCR
Author(s) name	Dorlass EG, Monteiro CO et al.
Journal	Braz J Microbiol
Impact factor	1.67 Citation count: 19

NLM format

Dorlass EG, Monteiro CO, Viana AO, Soares CP, Machado RRG, Thomazelli LM, Araujo DB, Leal FB, Candido ED, Telezynski BL, Valério CA, Chalup VN, Mello R, Almeida FJ, Aguiar AS, Barrientos ACM, Sucupira C, De Paulis M, Sáfadi MAP, Silva DGBP, Sodré JJM, Soledade MP, Matos SF, Ferreira SR, Pinez CMN, Buonafine CP, Pieroni LNF, Malta FM, Santana RAF, Souza EC, Fock RA, Pinho JRR, Ferreira LCS, Botosso VF, Durigon EL, Oliveira DBL. Lower cost alternatives for molecular diagnosis of COVID-19: conventional RT-PCR and SYBR Green-based RT-qPCR. Braz J Microbiol. 2020 Sep;51(3):1117-1123. PMID:32767275

Reporting a two-step SYBR Green-based RT-qPCR assay specific for the E gene of SARS-CoV-2, which can be used as a lower-cost alternative to TaqMan RT-qPCR assay.

The SYBR Green-based assay was able to detect all 8 dilutions of the isolate. The average Ct variation between SYBR Green and TaqMan was 1.92 ✍

32767275
(Braz J Microbiol)

PMID	32767275 Date of Publishing: 2020 Sep
Title	Lower cost alternatives for molecular diagnosis of COVID-19: conventional RT-PCR and SYBR Green-based RT-qPCR
Author(s) name	Dorlass EG, Monteiro CO et al.
Journal	Braz J Microbiol
Impact factor	1.67 Citation count: 19

NLM format

Comparative study of diagnosis of COVID-19 by chest CT scans and RT-PCR assay showed that chest CT scans for the primary screening of COVID-19 showed a low positive predictive value than RT-PCR assay. For chest CT scans and RT-PCR, the Positive predictive value ranged from 1.5%-30.7% and 47.3%-96.4%, respectively.

✍

32301646
(Radiology)

PMID	32301646 Date of Publishing: 2020 Sep
Title	Diagnostic Performance of CT and Reverse Transcriptase-Polymerase Chain Reaction for Coronavirus Disease 2019: A Meta-Analysis
Author(s) name	Kim H, Hong H, Yoon SH.
Journal	Radiology
Impact factor	7.11 Citation count: 273

NLM format
Kim H, Hong H, Yoon SH. Diagnostic Performance of CT and Reverse Transcriptase-Polymerase Chain Reaction for Coronavirus Disease 2019: A Meta-Analysis. Radiology. 2020 Sep;296(3):E145-E155. PMID:32301646

Reporting a rapid, inexpensive method, Direct RT-qPCR to detect SARS-CoV-2 from all respiratory specimens by targeting the E gene. The assay had a detection rate of 95.8 % for Ct values <35.

Direct RT-qPCR works well with fresh samples (storage <1 week). ✍

32795959
(J Clin Virol)

PMID	32795959 Date of Publishing: 2020 Sep
Title	Extraction-free SARS-CoV-2 detection by rapid RT-qPCR universal for all primary respiratory materials
Author(s) name	Lübke N, Senff T et al.
Journal	J Clin Virol
Impact factor	2.95 Citation count: 44

NLM format
Lübke N, Senff T, Scherger S, Hauka S, Andrée M, Adams O, Timm J, Walker A. Extraction-free SARS-CoV-2 detection by rapid RT-qPCR universal for all primary respiratory materials. J Clin Virol. 2020 Sep;130:104579. PMID:32795959

Reporting DIOS RT-qPCR assay, which targets two regions of nucleocapsid genes (N1, N2) to detect SARS-CoV-2.

Ct value of <40, was indicative of a SARS-CoV-2-positive sample. The pre-treatment of the swab sample by heat inactivation (75 degree Celsius for 10 min) was also tested. No significant changes in heat inactivation were observed. Comparative analysis of swab samples by DIOS-RT-qPCR (directly from a swab) and an IVD CE-certified RT-qPCR kit (using extracted RNA) was performed, 98% concordance results were observed. ✍

32824767
(Diagnostics (Basel))

PMID	32824767 Date of Publishing: 2020 Aug 18
Title	Direct-RT-qPCR detection of SARS-CoV-2 without RNA extraction as part of a Covid-19 testing strategy: From sample to result in one hour
Author(s) name	Kriegova E, Fillerova R, Kvapil P.
Journal	Diagnostics (Basel)
Impact factor	2.36 Citation count: 18

NLM format
Kriegova E, Fillerova R, Kvapil P. Direct-RT-qPCR detection of SARS-CoV-2 without RNA extraction as part of a Covid-19 testing strategy: From sample to result in one hour. Diagnostics (Basel). 2020 Aug 18;10(8):605. PMID:32824767

Reporting diagnostic panel developed by US CDC consists of 3 real-time reverse transcription PCR assays specific for detecting the nucleocapsid gene of SARS-COV-2.

N1 and N2 assays specifically detect SARS-CoV-2 while N3 assay detects all viruses within the subgenus Sarbecovirus ✍

32396505
(Emerg Infect Dis)

PMID	32396505 Date of Publishing: 2020 Aug
Title	US CDC Real-Time Reverse Transcription PCR Panel for detection of Severe Acute Respiratory Syndrome Coronavirus 2
Author(s) name	Lu X, Wang L et al.
Journal	Emerg Infect Dis
Impact factor	6.81 Citation count: 205

NLM format
Lu X, Wang L, Sakthivel SK, Whitaker B, Murray J, Kamili S, Lynch B, Malapati L, Burke SA, Harcourt J, Tamin A, Thornburg NJ, Villanueva JM, Lindstrom S. US CDC Real-Time Reverse Transcription PCR Panel for detection of Severe Acute Respiratory Syndrome Coronavirus 2. Emerg Infect Dis. 2020 Aug;26(8):1654-65. PMID:32396505

The implementation of real-time RT-PCR for the detection of COVID-19 based on SARS-CoV-2 nucleocapsid gene set 1 and 2.

✍

32074516
(Jpn J Infect Dis)

PMID	32074516 Date of Publishing: 2020 Jul 22
Title	Development of genetic diagnostic methods for detection for Novel Coronavirus 2019 (nCoV-2019) in Japan
Author(s) name	Shirato K, Nao N et al.
Journal	Jpn J Infect Dis
Impact factor	1.11 Citation count: 207

NLM format
Shirato K, Nao N, Katano H, Takayama I, Saito S, Kato F, Katoh H, Sakata M, Nakatsu Y, Mori Y, Kageyama T, Matsuyama S, Takeda M. Development of genetic diagnostic methods for detection for Novel Coronavirus 2019 (nCoV-2019) in Japan. Jpn J Infect Dis. 2020 Jul 22;73(4):304-307. PMID:32074516

SARS-CoV-2 was detected, from feces specimens, by using the qRT-PCR method.

The primers and probe of ORF1ab gene (taken from PMID- 32031570): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3. ✍

32159775
(JAMA)

PMID	32159775 Date of Publishing: 2020 May 12
Title	Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) name	Wang W, Xu Y et al.
Journal	JAMA
Impact factor	14.78 Citation count: 2310

SARS-CoV-2 was detected, from urine specimens, by using the qRT-PCR method.

32159775
(JAMA)

PMID	32159775 Date of Publishing: 2020 May 12
Title	Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) name	Wang W, Xu Y et al.
Journal	JAMA
Impact factor	14.78 Citation count: 2310

SARS-CoV-2 was detected, from blood specimens, by using the qRT-PCR method.

32159775
(JAMA)

PMID	32159775 Date of Publishing: 2020 May 12
Title	Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) name	Wang W, Xu Y et al.
Journal	JAMA
Impact factor	14.78 Citation count: 2310

SARS-CoV-2 was detected, from pharyngeal swab specimens, by using the qRT-PCR method.

32159775
(JAMA)

PMID	32159775 Date of Publishing: 2020 May 12
Title	Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) name	Wang W, Xu Y et al.
Journal	JAMA
Impact factor	14.78 Citation count: 2310

SARS-CoV-2 was detected, from nasal swab specimens, by using the qRT-PCR method.

32159775
(JAMA)

PMID	32159775 Date of Publishing: 2020 May 12
Title	Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) name	Wang W, Xu Y et al.
Journal	JAMA
Impact factor	14.78 Citation count: 2310

SARS-CoV-2 was detected, from sputum samples, by using the qRT-PCR method.

32159775
(JAMA)

PMID	32159775 Date of Publishing: 2020 May 12
Title	Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) name	Wang W, Xu Y et al.
Journal	JAMA
Impact factor	14.78 Citation count: 2310

SARS-CoV-2 was detected, from fibrobronchoscope brush biopsy specimens, by using the qRT-PCR method.

32159775
(JAMA)

PMID	32159775 Date of Publishing: 2020 May 12
Title	Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) name	Wang W, Xu Y et al.
Journal	JAMA
Impact factor	14.78 Citation count: 2310

SARS-CoV-2 was detected, from Bronchoalveolar lavage fluid samples, by using the qRT-PCR method.

32159775
(JAMA)

PMID	32159775 Date of Publishing: 2020 May 12
Title	Detection of SARS-CoV-2 in different types of clinical specimens
Author(s) name	Wang W, Xu Y et al.
Journal	JAMA
Impact factor	14.78 Citation count: 2310

Reporting a RT-qPCR assay specific for ORF 1b and N gene of SARS-CoV-2 and closely related species.

Phylogenetic analyses were performed for SARS coronavirus, bat SARS-like coronaviruses, and other representative coronaviruses sequences. The primers and probe sequences were designed based on Genbank (Accession number: MN908947). ✍

32031583
(Clin Chem)

PMID	32031583 Date of Publishing: 2020 Apr 1
Title	Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of Pneumonia
Author(s) name	Chu DKW, Pan Y et al.
Journal	Clin Chem
Impact factor	4.75 Citation count: 557

NLM format
Chu DKW, Pan Y, Cheng SMS, Hui KPY, Krishnan P, Liu Y, Ng DYM, Wan CKC, Yang P, Wang Q, Peiris M, Poon LLM. Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of Pneumonia. Clin Chem. 2020 Apr 1;66(4):549-555. PMID:32031583

Reporting a qPCR-based detection method specific for the detection of the receptor-binding domain of the S gene of SARS-CoV-2.

Samples from oral swabs, anal swabs and blood from 2019-nCoV positive patients were found to be negative during the second sampling. ✍

32015507
(Nature)

PMID	32015507 Date of Publishing: 2020 Mar
Title	A pneumonia outbreak associated with a new coronavirus of probable bat origin
Author(s) name	Zhou P, Yang XL et al.
Journal	Nature
Impact factor	24.36 Citation count: 8438

NLM format
Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, Si HR, Zhu Y, Li B, Huang CL, Chen HD, Chen J, Luo Y, Guo H, Jiang RD, Liu MQ, Chen Y, Shen XR, Wang X, Zheng XS, Zhao K, Chen QJ, Deng F, Liu LL, Yan B, Zhan FX, Wang YY, Xiao GF, Shi ZL. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 2020 Mar;579(7798):270-273. PMID:32015507

Reporting RT-qPCR N gene assay which, can be used as the additional confirmatory assay for SARS-CoV-2 detection.

The assay was designed and validated by 2003 SARS-CoV (GenBank NC_004718) which, showed alignment to six available sequences of 2019-nCoV ✍

31992387
(Euro Surveill)

PMID	31992387 Date of Publishing: 2020 Jan
Title	Detection of Covid 19 novel coronavirus (2019 -nCoV) by real-time RT-PCR
Author(s) name	Corman VM, Landt O et al.
Journal	Euro Surveill
Impact factor	7.37 Citation count: 3073

NLM format

Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK, Bleicker T, Brünink S, Schneider J, Schmidt ML, Mulders DG, Haagmans BL, van der Veer B, van den Brink S, Wijsman L, Goderski G, Romette JL, Ellis J, Zambon M, Peiris M, Goossens H, Reusken C, Koopmans MP, Drosten C. Detection of Covid 19 novel coronavirus (2019 -nCoV) by real-time RT-PCR. Euro Surveill. 2020 Jan;25(3):2000045. PMID:31992387

Reporting RT-qPCR RdRP gene assay which, can be used as the confirmatory test for SARS-CoV-2 detection.

The assay was designed and validated by 2003 SARS-CoV (GenBank NC_004718) which, showed alignment to six available sequences of 2019-nCoV ✍

31992387
(Euro Surveill)

PMID	31992387 Date of Publishing: 2020 Jan
Title	Detection of Covid 19 novel coronavirus (2019 -nCoV) by real-time RT-PCR
Author(s) name	Corman VM, Landt O et al.
Journal	Euro Surveill
Impact factor	7.37 Citation count: 3073

NLM format

Reporting RT-qPCR E gene assay which, can be used as the first-line screening test for SARS-CoV-2 detection.

The assay was designed and validated by 2003 SARS-CoV (GenBank NC_004718) which, showed alignment to six available sequences of 2019-nCoV ✍

31992387
(Euro Surveill)

PMID	31992387 Date of Publishing: 2020 Jan
Title	Detection of Covid 19 novel coronavirus (2019 -nCoV) by real-time RT-PCR
Author(s) name	Corman VM, Landt O et al.
Journal	Euro Surveill
Impact factor	7.37 Citation count: 3073

NLM format